archive-com.com » COM » B » BASECLEAR.COM

Total: 176

Choose link from "Titles, links and description words view":

Or switch to "Titles and links view".
  • Baseclear - Standard primer list
    expression and purification Peptide synthesis Custom antibody service Kisker Biotech Lab disposables Lab equipment Microparticles Industries Industrial Biotechnology Food Ingredients Pharma Health Water Environment Clinical Diagnostics laboratories Agro Sciences Academic Research institutes About BaseClear Our company Meet our team History Partners Distributors Why BaseClear Reasons to work with BaseClear Research development Quality assurance Technologies Information News Ordering Career Jobs Internships Contact Contact details Contact form Request quotation Order forms Blog Home Our services Lab Products Industries About BaseClear Blog Next Gen sequencing Bioinformatics Sanger sequencing Project sequencing Single runs 96 well plates Fragment analysis SNP and VNTR analysis Microbiology Synthetic Biology STANDARD PRIMER LIST SANGER SEQUENCING The primers below are available at BaseClear There is no need to ship these with your sequencing order In addition we offer the possibility to store your custom primers when used regularly Client specific Please contact us to discuss the possibilities Download primers CLC primers BC clc Download primers fasta primers BC fasta fa Name Primer Sequence 3 AOX1 GCAAATGGCATTCTGACATCC 5 AOX1 GACTGGTTCCAATTGACAAGC AmpL1 ACAGTCCAGTTACGCTGGAGTC AmpR1 CTTTCTGCTATGGAGGTCAGGTATG attL1 Fw ACTTAAGCTCGGGCCCCAAA attL2 Rv TGTAACATCAGAGATTTTGAGACA BGH2 GAACTAGAAGGCACAGTCGAGG CMV fw2 CGTGTACGGTGGGAGGTCT MF TTTCCCAGTCACGACGTTG MF 47 CGCCAGGGTTTTCCCAGTCACGAC MF 20i GTAAAACGACGGCCAG MR GGATAACAATTTCACACAGG MR invitrogen CAGGAAACAGCTATGACC pBAD Forward ATGCCATAGCATTTTTATCC

    Original URL path: http://www.baseclear.com/genomics/sanger-sequencing/standard-primer-list (2016-02-12)
    Open archived version from archive


  • Baseclear - Abbreviations
    fungal identifications Microbial typing Microbial diversity analysis Microbial genome sequencing Virus sequencing Mycoplasma detection Synthetic Biology Synthetic DNA libraries Gene synthesis Custom cloning PCR cloning Mutagenesis Lab Products Zymo Research Epigenetics DNA purification RNA purification Other products Sample kits Epigenetic services Bio Basic Gene Synthesis Protein expression and purification Peptide synthesis Custom antibody service Kisker Biotech Lab disposables Lab equipment Microparticles Industries Industrial Biotechnology Food Ingredients Pharma Health Water Environment Clinical Diagnostics laboratories Agro Sciences Academic Research institutes About BaseClear Our company Meet our team History Partners Distributors Why BaseClear Reasons to work with BaseClear Research development Quality assurance Technologies Information News Ordering Career Jobs Internships Contact Contact details Contact form Request quotation Order forms Blog Home Our services Lab Products Industries About BaseClear Blog Next Gen sequencing Bioinformatics Sanger sequencing Project sequencing Single runs 96 well plates Fragment analysis SNP and VNTR analysis Microbiology Synthetic Biology ABBREVIATIONS SANGER SEQUENCING HS High signal LS Low signal NO No signal SD Signal drop SS Signal stop DS Double signal DB Double signal at the start DE Double signal at the end EC Echo signal after a stretch BP Broad peaks at the end BG Background signal SP Spike in the sequence

    Original URL path: http://www.baseclear.com/genomics/sanger-sequencing/abbreviations (2016-02-12)
    Open archived version from archive

  • Baseclear
    Netherlands today announce the start of their joint venture ProBase Pharma www probasepharma com ProBase Pharma will offer a complete portfolio of molecular based rapid testing services under strict GXP conditions to the international bio pharmaceutical market BaseClear is a leading player in the field of molecular DNA based testing services to the international life sciences market The company has a 20 year track record of expertise in genomics and bioinformatics solutions based on state of the art technologies Sinensis Life Sciences is an active player with a strong portfolio of QC services for bio pharmaceutical chemistry and microbiology biosafety testing analytical R D and contract manufacturing and it serves over 400 customers around the globe The combination of the knowledge and strong expertise on molecular and DNA based testing by BaseClear an the GXP experience and knowledge of the pharma and biotech market of Sinensis Life Sciences provides ProBase Pharma with a strong foundation and a head start advantage The need for more rapid and more advanced contract testing services in the pharmaceutical market has become apparent as regulatory authorities have started to accept novel technologies as an alternative to classic testing These new technologies hold the promise of faster and more accurate results as well as being applicable to a range of novel therapeutics for which the current assays are not ProBase Pharma will start by offering microbial identification and typing services based on DNA and proteomics technologies In the near future the service package will be expanded by offering services based on the newest genomics technologies including NextGeneration DNA sequencing but also Sanger GXP sequencing and RealTime PCR assays will be part of the portfolio Moreover through a strong internal R D program these technologies will be combined to offer a portfolio currently not available from any

    Original URL path: http://www.baseclear.com/news/BaseClear-BV-and-Sinensis-Life-Sciences-BV-announce-the-start-of-ProBase-Pharma_90_18.html (2016-02-12)
    Open archived version from archive

  • Baseclear
    Synthetic DNA libraries Gene synthesis Custom cloning PCR cloning Mutagenesis Lab Products Zymo Research Epigenetics DNA purification RNA purification Other products Sample kits Epigenetic services Bio Basic Gene Synthesis Protein expression and purification Peptide synthesis Custom antibody service Kisker Biotech Lab disposables Lab equipment Microparticles Industries Industrial Biotechnology Food Ingredients Pharma Health Water Environment Clinical Diagnostics laboratories Agro Sciences Academic Research institutes About BaseClear Our company Meet our team History

    Original URL path: http://www.baseclear.com/microbiology/microbial-identification/bacterial-identification (2016-02-12)
    Open archived version from archive

  • Baseclear
    exclusive distributor of Bio Basic services and products within The Netherlands Belgium Italy and Scandinavia Denmark Sweden Iceland Norway Finland With this collaboration BaseClear wants to serve its customers even better as a total supplier in the field of DNA based laboratory services We already work together with Bio Basic in the field of gene synthesis for a long time and we have many customers using this service to their full satisfaction Because of this new formal partnership we can now offer this gene synthesis service for the best price in the market Bas Reichert CEO of BaseClear adds Additionally we are expanding our portfolio with services like peptide synthesis and the expression and purification of proteins as well as a custom antibody service This allows us to offer an even more complete package of services from gene to protein Bio Basic is also very pleased with the new formal cooperation We already have many distributors of our service spanning all continents says Nadine Lewis Marketing Manager Bio Basic This agreement with BaseClear is part of our ambitious plans to provide customers all around the world with the best services possible Because of our lowest price guarantee for gene synthesis we see a lot of growth in customers for this service In addition our peptide synthesis and protein expression and purification services are very successful More and more customers are finding us and use Bio Basic as their premium supplier About Bio Basic Bio Basic Group is a privately owned dynamic biotechnology company located in Markham Canada The company has a wide variety of Life Science Products available to better serve researchers in the field of life sciences Bio Basic Group is committed to innovation and excellence Throughout its development Bio Basic Group has continuously directed efforts into R D

    Original URL path: http://www.baseclear.com/news/Collaboration-Bio-Basic-and-BaseClear-on-synthetic-biology_90_23.html (2016-02-12)
    Open archived version from archive

  • Baseclear
    The issue has been given high priority both at the European level EU Biodiversity Strategy to 2020 and the global level UN Convention on Biological Diversity In the Netherlands we have legal and regulatory frameworks such as the European Water Framework Directive WFP and Natura 2000 and the Flora and Fauna Act the purpose of which is to ensure the protection of biodiversity A number of nature inventories are conducted within these frameworks The inventories and identifications are made on the basis of morphological characteristics either with or without the use of microscopes These classic methods demand specialist knowledge and are labour intensive and time consuming and therefore expensive Moreover one has to wait a long time for the results DNA techniques in turn can reduce costs and generate faster results Naturalis TKI partner In April 2014 the knowledge entities KWR Watercycle Research Institute Naturalis Biodiversity Center University of Applied Sciences Leiden and Stichting EIS together with the consultancies Royal HaskoningDHV and Koeman Bijkerk and the DNA technology company BaseClear launched a TKI project aimed at connecting field expertise to DNA results The project is enriching in two ways first the tracing and identification of the animal species and plants expands the DNA reference database which is essential in enabling the derivation of specific species names from the DNA encountered And second the use of the DNA results can also incite hydrobiological analysts to begin looking for the specific organism that they failed to find in their own searches Thanks to DNA techniques we can determine in a routine and reliable manner the species that are present in water samples We make our collection and knowledge available for purposes of water management and together give a strong impulse to water quality diagnostics says Berry van der Hoorn programme leader of

    Original URL path: http://www.baseclear.com/news/BaseClear-contributes-to-knowledge-of-biodiversity-and-water-assessment_90_24.html (2016-02-12)
    Open archived version from archive

  • Baseclear
    throughput assembly and annotation pipeline New high throughput assembly and annotation pipeline Our bioinformatics team has now completed the setup of a high throughput HT assembly and annotation pipeline which rapidly turns nucleotides into meaningful genomes at an incredibly low price After an extensive filtering i e removal of adapters and phix and trimming i e removal of low quality bases of the raw reads the polished reads are fed to our de novo assembly pipeline This unique masterpiece connects the best available assembly software tools to guarantee high quality assemblies First a draft assembly is computed using CLCbio s de novo assembly tool currently considered the state of the art assembler in the field The draft genome is further polished using our highly cited BaseTools SSPACE Premium for scaffolding and GapFiller for automated gap closure Second the finished genomes are annotated using our brand new annotation pipeline which is based on the Prokka Prokaryotic Genome Annotation System It includes a number of features among which CDS prediction annotation using BLAST on the UniProt sequence database PFAM protein family prediction rRNA identification and Signal peptide prediction The annotations are delivered in a number of standard formats Excel GFF GenBank Sequin and more but we also provide free access to our online annotation browser which allows interactive analyses of the results Different search options provide our customers with a unique tool to scan their genomes for genes or enzymes of interest Also a local BLAST search is implemented to screen assembled genomes for particular gene of protein query sequences High throughput solutions to sequence entire bacterial strain collections Using Robotics like the Beckman Coulter Ffix we are able to prep 96 wells plates of bacterial genome libraries in a cost effective and very short time The multiplexed libraries will be sequenced

    Original URL path: http://www.baseclear.com/news/New-high-throughput-assembly-and-annotation-pipeline_20_17.html (2016-02-12)
    Open archived version from archive

  • Baseclear - Virus Diagnostics
    sequencing Mycoplasma detection Synthetic Biology Synthetic DNA libraries Gene synthesis Custom cloning PCR cloning Mutagenesis Lab Products Zymo Research Epigenetics DNA purification RNA purification Other products Sample kits Epigenetic services Bio Basic Gene Synthesis Protein expression and purification Peptide synthesis Custom antibody service Kisker Biotech Lab disposables Lab equipment Microparticles Industries Industrial Biotechnology Food Ingredients Pharma Health Water Environment Clinical Diagnostics laboratories Agro Sciences Academic Research institutes About BaseClear Our company Meet our team History Partners Distributors Why BaseClear Reasons to work with BaseClear Research development Quality assurance Technologies Information News Ordering Career Jobs Internships Contact Contact details Contact form Request quotation Order forms Blog Home Our services Lab Products Industries About BaseClear Blog Next Gen sequencing Bioinformatics Assembly and annotation Comparative genomics RNA seq analysis Microbial profiling analysis Interactive online platforms BaseTools software Sanger sequencing Microbiology Synthetic Biology VIRUS DIAGNOSTICS PLATFORM on the fly analysis of viral communities in plants Our bioinformatics team is currently busy with the development of an online portal for viral diagnostics This will allow our customers on the fly analysis of viral communities in plants The official release of the portal is expected mid 2016 Meet Walter Pirovano Walter is director of the bioinformatics

    Original URL path: http://www.baseclear.com/genomics/bioinformatics/online-platforms/Virusdgx (2016-02-12)
    Open archived version from archive